Skip to main content

Table 3 Primers used for quantitative PCR analysis.

From: Off-target effects dominate a large-scale RNAi screen for modulators of the TGF-β pathway and reveal microRNA regulation of TGFBR2

CDKN1A-fw CCGAGGCACTCAGAGGAG
CDKN1A-rev AGCTGCTCGCTGTCCACT
SERPINE1-fw AAGGCACCTCTGAGAACTTCA
SERPINE1-rev CCCAGGACTAGGCAGGTG
HPRT1-fw TGACCTTGATTTATTTTGCATACC
HPRT1-rev CGAGCAAGACGTTCAGTCCT
SMAD4-fw CCTGTTCACAATGAGCTTGC
SMAD4-rev GCAATGGAACACCAATACTCAG
SMAD7-fw AGGGGGAACGAATTATCTGG
SMAD7-rev ACCACGCACCAGTGTGAC
TGFBR1-fw TGTTACGTCATGAAAACATCCTG
TGFBR1-rev ACCAGAGCTGAGTCCAAGTACC
TGFBR2-fw GACCAGAAATTCCCAGCTTCT
TGFBR2-rev CAACGTCTCACACACCATCTG